U Assume rabbit coat color and ear size are controlled by two unlinked genes, each with two alleles that exhibit complet

[answerhappygod]

U Assume Rabbit Coat Color And Ear Size Are Controlled By Two Unlinked Genes Each With Two Alleles That Exhibit Complet 1 (32.93 KiB) Viewed 9 times

U Assume Rabbit Coat Color And Ear Size Are Controlled By Two Unlinked Genes Each With Two Alleles That Exhibit Complet 2 (34.56 KiB) Viewed 9 times

U Assume Rabbit Coat Color And Ear Size Are Controlled By Two Unlinked Genes Each With Two Alleles That Exhibit Complet 3 (45.83 KiB) Viewed 9 times

U Assume Rabbit Coat Color And Ear Size Are Controlled By Two Unlinked Genes Each With Two Alleles That Exhibit Complet 4 (46.68 KiB) Viewed 9 times

U Assume Rabbit Coat Color And Ear Size Are Controlled By Two Unlinked Genes Each With Two Alleles That Exhibit Complet 5 (52.81 KiB) Viewed 9 times

U Assume rabbit coat color and ear size are controlled by two unlinked genes, each with two alleles that exhibit complete dominant/recessive inheritance. For the following mating: a female white haired rabbit that is heterozygous at the gene for ear length and has long ears is mated with a male black haired rabbit with long ears that is heterozygous at both genes. (use C (and/or c) as the letters for the hair color alleles and use E (and/or e) as the letter for the ear length alleles) Question 21 The genotype of the male is while the female's genotype is 2 pts
D Question 22 What are all of the potential gametes from the male? Question 23 What are all the potential gametes from the female? 4 pts 2 pts
D Question 24 2 pts What is the predicted phenotypic ratio of the potential offspring for this mating? (please use a #:#:#:# format with no spaces- for your answer-it should look like 1:57:3:19 (that is not the answer)). For the following sequence, write the complementary DNA strand (include 5'and 3' direction), then transcribe the appropriate sequence (include 5'and 3' direction) into mRNA then translate the mRNA into a protein (use 1 letter code) then answer questions 25-27. 5' GGCTATGATTCGCGCGTGCCTGGAATAACTGC 3'
Question 25 What is the complementary DNA sequence? (I am asking you to write the other strand as it would be represented if both strands were present reading from left to right) O 5' CCGATACTAAGCGCGCACGGACCTTATTGACG 3¹ O 3' GGCTATGATTCGCGCGTGCCTGGAATAACTGC 5¹ O 3' CCGATACTAAGCGCGCACGGACCTTATTGACG 5' O5' GGCUAUGAUUCGCGCGUGCCUGGAAUAACUGC 3' Question 26 What is the messenger RNA (mRNA) sequence that would be transcribed? 2 pts 3' CCGATACTAAGCGCGCACGGACCTTATTGACG 5' O 5' GGCUAUGAUUCGCGCGUGCCUGGAAUAACUGC 3' O 5' CCGAUACUAAGCGCGCACGGACCUUAUUGACG 3' O 3' GGCUAUGAUCGCGCGUGCCUGGAAUAACUGC 5" 3 pts
First base What is the protein sequence (using the one letter code) that would be translated? Second base U G C U Phenyl- UUCJ alanine F UUG-Leucine L CUUT CUC CUA CUG AUUT AUC A AUA GUUT GUC GUA GUG UCUT UCC UCA UCG. I -Isoleucine ACC ACA AUG MMethionine ACG. start codon CCUT -Leucine I CCC CCA CCG -Valine V ACUT GCUT GCC GCA GCG с Serine Proline P UAA S Threonine T -Alanine UAUT UACJ A A -Tyrosine Y Stop codon UAG Stop codon CAUT CAC AA-Asparagine AAA-Lysine N K Histidine H CGA CAA Glutamine CGG] GAU Aspartic GAC acid GAGGlutamic D UGU UGCJ G CQU CGC Cysteine UGA Stop codon UGG Tryptophan G E -Arginine AGUT AGC Serine S AGA-Arginine R GGUT GGC GGA GGG R -Glycine pts SCAG G DOAG SCAG Third base SCAO