Page 1 of 1

The trp operon includes the trp promoter, the trp operator, and trpl, trpE, trpD, trpC, trpB, and trpA. trpL is the lead

Posted: Tue Jul 05, 2022 7:41 am
by answerhappygod
The Trp Operon Includes The Trp Promoter The Trp Operator And Trpl Trpe Trpd Trpc Trpb And Trpa Trpl Is The Lead 1
The Trp Operon Includes The Trp Promoter The Trp Operator And Trpl Trpe Trpd Trpc Trpb And Trpa Trpl Is The Lead 1 (65.89 KiB) Viewed 15 times
The Trp Operon Includes The Trp Promoter The Trp Operator And Trpl Trpe Trpd Trpc Trpb And Trpa Trpl Is The Lead 2
The Trp Operon Includes The Trp Promoter The Trp Operator And Trpl Trpe Trpd Trpc Trpb And Trpa Trpl Is The Lead 2 (47.02 KiB) Viewed 15 times
The trp operon includes the trp promoter, the trp operator, and trpl, trpE, trpD, trpC, trpB, and trpA. trpL is the leader that determines whether attenuation occurs and the rest of the genes are translated to produce enzymes that synthesize tryptophan. The following sequence shows the trp promoter, the trp operator, all of trpL and the beginning of the trpE DNA sequence. Regions corresponding to stem-loops # 1/# 2 and #3/#4 are over-lined and labeled while regions corresponding to the alternate stem-loop # 2/#3 is underlined and labeled (note: underlining or over-lining has nothing to do with which strand participates in the stem-loop). The sequences corresponding to the Shine-Delgarno sequences for the trpL and trpE genes are represented by asterisks. The base-pairs that comprise the trp operator have "+" above them. The trp promoter has a perfect -35 hexamer, a 17 bp spacer and weak similarity to the -10 hexamer consensus. There are eight different base-pair mutants labeled a. through h. (note: mutants f. and g. are double base-pair substitutions). A indicates a single bp deletion. 5-GARATGAGCTGITGACAATTAATCATCGAACTAGTTAACTAGTACGCAAGTTCACGTAAAAAGE AfCGACAATGAAAG 3'-CTTTACTCGACAACTGTTAATTAGTAGCTTGATCAATT ATGCGTTCAAGTGCATTTTTCCCATAGCTOTTACTTTC CAATTTTCGTACTGAAAGGTTGGTGGCGCACTTCCTG #4 d. #3 TCAGATACCCAGCCCGCCTAATGAGCO #1 AGTCTATGGG GGCGGATTACTCO #3 GTTAAAAGCATGACTTTCCAACCACCGCGTGAAGGACTTTGCCCGTCACATAAGTGGTACGCATTTCGTT operator #2 CG GC CAGTGTATTCACCATGCGTAAAGCAA #2 ******* AATTAGAGAATAACAATGCAAACA.3 TCTCTTATTGTTACGTTTGT 5* T A 9. h. The following figure shows the alternate stem loop structures that form in the mRNA: LLL (next page) Highly low tript tr
Fill in the following table for how the listed mutation affects the amount of TrpE enzyme produced (relative to wild type) for the case where tryptophan levels in the cell are low and when levels are high. Possible effects are 1, 4, or NE (no effect). Note: even under fully repressing conditions, there is still a low basal level of TrpE produced in the wild type strain. Hint: think about the level of expression for the wild type under the particular condition examined. e.g. if expression in the wild type is high (due to lack of repression, then a mutation that eliminates repression will have no effect under those conditions. Add comments for why you came up with the answer you did for full credit. (8 points) mutant a. b. C. d. g. h. TrpE produced Low [tryptophan] High [tryptophan] comments Describe an intergenic suppressor mutation that would suppress mutant b. illustrated above. Describe an intragenic suppressor mutation that would suppress mutation c. illustrated above. (2 points)