Page 1 of 1

there are four blanks in the questions

Posted: Thu Jun 30, 2022 6:37 pm
by answerhappygod
there are four blanks in the questions
There Are Four Blanks In The Questions 1
There Are Four Blanks In The Questions 1 (47.73 KiB) Viewed 56 times
There Are Four Blanks In The Questions 2
There Are Four Blanks In The Questions 2 (47.73 KiB) Viewed 56 times
A promoter re- gion can be blocked by an- other protein. Histone deacetylation can pre- vent DNA from unwinding. Alternative splicing within the gene Start sequence can lead to different forms wedd gene ATGACGGATCAGCCGCAAGCGGAATTGGCGACATAA ▬▬▬▬▬▬▬▬▬▬▬▬▬ Stop TACTGCCTAGTO CGTTCGCCTTAACCGCTGTATT A possible location for a regulatory region that can be bound and increase transcription rates.