A promoter re- gion can be blocked by an- other protein. Histone deacetylation can pre- vent DNA from unwinding. Alterna
Posted: Thu Jun 30, 2022 6:37 pm
A promoter re- gion can be blocked by an- other protein. Histone deacetylation can pre- vent DNA from unwinding. Alternative splicing within the gene Start sequence can lead to different forms wedd gene ATGACGGATCAGCCGCAAGCGGAATTGGCGACATAA ▬▬▬▬▬▬▬▬▬▬▬▬▬ Stop TACTGCCTAGTO CGTTCGCCTTAACCGCTGTATT A possible location for a regulatory region that can be bound and increase transcription rates.