Page 1 of 1
Click Submit to complete this assessment. Question 25 Study the base of the DNA sequence below. If EcoRI recognizes base
Posted: Thu Jun 30, 2022 6:36 pm
by answerhappygod
- Click Submit To Complete This Assessment Question 25 Study The Base Of The Dna Sequence Below If Ecori Recognizes Base 1 (65.38 KiB) Viewed 53 times
Click Submit to complete this assessment.
Question 25 Study the base of the DNA sequence below. If EcoRI recognizes base sequence of GAATTC, how many DNA fragments (double stranded) will be produced after EcoRI digestion of this DNA 5'ACGCGAATTGAATTCGATCGAATCCAGTAGCCGCAATTCCAAGAATTCTTC 3' 3TGCGCTTAACTTAAGCTAGCTTAGGTCATCGGCGTTAAGGTTCTTAAGAAG 5' For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). BIU S Paragraph. V Arial A Click Submit to complete this assessment. S 10pt N EM EM Av AV I XOQ MacBook Air