Page 1 of 1

This is a double-stranded DNA sequence--with no Introns--that codes for a small protein (this is a hypothetical example:

Posted: Mon Jan 24, 2022 9:12 am
by answerhappygod
This Is A Double Stranded Dna Sequence With No Introns That Codes For A Small Protein This Is A Hypothetical Example 1
This Is A Double Stranded Dna Sequence With No Introns That Codes For A Small Protein This Is A Hypothetical Example 1 (45.19 KiB) Viewed 53 times
This Is A Double Stranded Dna Sequence With No Introns That Codes For A Small Protein This Is A Hypothetical Example 2
This Is A Double Stranded Dna Sequence With No Introns That Codes For A Small Protein This Is A Hypothetical Example 2 (27.51 KiB) Viewed 53 times
This Is A Double Stranded Dna Sequence With No Introns That Codes For A Small Protein This Is A Hypothetical Example 3
This Is A Double Stranded Dna Sequence With No Introns That Codes For A Small Protein This Is A Hypothetical Example 3 (73.1 KiB) Viewed 53 times
This is a double-stranded DNA sequence--with no Introns--that codes for a small protein (this is a hypothetical example: real genes are much longer and have Introns). Transcription begins at the Transcription Start Site, which is the A/T base pair Indicated by "TSS" and gold shading. Transcription stops at the G/C base pair marked with the arrow. 5'... GACAGACTATGACATAATGCACATAAGAATTTATTTTATA ... 3' TII 3'... CTGTCTGATACTGTATTACGTGTATTCTTAAATAAAATAT ... 5 TSS Part 1 The template strand for transcription is the bottom strand. In addition to the location of the transcription start site (TSS) the template strand can be identified because the top strand (coding strand) contains, at its 5' end, the site forbinding to the polymerase, the TATAA box and the site for Initiation of translation, the transcription initiation site
Part 2 What is the sequence of the mRNA transcribed from this sequence? O 5' CUGAUACUGUAUUACGUGUAUUCUUAAAU 3' 05' AUUUAAGAAVACACGUAAVACAGUAUCAG 3' 5' VAAAUUCUUAUGUGCAUUAUGUCAUAGUC 3' 5' GACUAUGACAUAAUGCACAUAAGAAUUUA 3'
UGA stop UAG stop Indicate the sequence of amino acids that will be translated from the mRNA you determined in Part 2 by placing their labels in the boxes within the gold circles below. Start with the leftmost circle. You may not need to fill all circles if there is a stop codon. Also Indicate the N and C termini of the strand of amino acids. Use the codon table below Second position U с A G UUU UCU UAU UGU U Phe Tyr Cys UUC UCC UAC UGC с Ser UUA UCA UAA stop А Leu UUG UCG UGG Trp G CUU CCU CAU CGU U His CUC CCC CAC Leu CGC с Pro CUA CCA CAA CGA A Gin CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC lle ACC AAC AGC Thr с AUA ACA AAA AGA ACG Lys Arg AAG AGG G GUU GCU GAU GGU U GUC Asp GCC Val GAC Ala GGC с GUA GCA GAA Gly GGA A GUG Glu GAG G Initiation Arg First position (5' end) G Third position (3' end) A A AUG Met ca G GCG GGG Termination d the concept covered in this question? I Muddy ✓ Submit Answer Trp Vi N terminus C terminus