Page 1 of 1
Kandids -XPO dybe2/DHSM Vor5y6-F4g5gJ3ppFX5pvJerwaRUUD/edit Ubrary Genesis Ocopyright Saving Extensions Help Last edit w
Posted: Thu Jun 09, 2022 12:02 pm
by answerhappygod
- Kandids Xpo Dybe2 Dhsm Vor5y6 F4g5gj3ppfx5pvjerwaruud Edit Ubrary Genesis Ocopyright Saving Extensions Help Last Edit W 1 (27.64 KiB) Viewed 274 times
Kandids -XPO dybe2/DHSM Vor5y6-F4g5gJ3ppFX5pvJerwaRUUD/edit Ubrary Genesis Ocopyright Saving Extensions Help Last edit was 2 minutes ago Times Now 12 + BIUA 82 H Michael Name Matiese Grosch Lisbin Ⓒ This gene segment was cloned from the enigmatic wedoneyet gene in Drosophila. A-TRANSCRIBE the DNA into mRNA by using the bottoin strand as a templite and beginning with the first nucleotide. Write the sequence below the DNA: DNA CGATTOTATATAGATGTTCATCAACATAAGTCACGAGGACTGACACOSTGGTG 3 3 GCTAACATATATCTACAAGTAGTTGTATICAGTGCTCCTGACTGTGGCACCACS B TRANSLATE the mRNA by starting at the first start codon using the genetic code on the page 2. It's helpful here to section the mRNAs into triplets after you find the start coden to help in this section. mRNA codons Ö