3. (15 pts total) Analyzing the Molecules of Life - Molecular Diagnostics An mRNA that encodes a variant of a human prot
Posted: Thu Jun 09, 2022 11:45 am
3. (15 pts total) Analyzing the Molecules of Life - Molecular Diagnostics An mRNA that encodes a variant of a human protein is as follows (the mutation is highlighted in red): CUUGUUAACAACUAAACGAACAAUCUUUGUUUUUCUUGUUUUAUUGCCACUAGUCUCUAG UCAGUGUGUUAAUCUUACAACCAGAACUCAAUUACCCCCUGCAUACACUAAUUCUUUCAC ACGUGGUGUUUAUUACCCUGACAAAGUUUUCAGAUCCUCAGUUUUACAUUCAACUCAGGA CUUGUUCUUACCUUUCUUUUCCAAUGUUACUUGGUUCCAUGCUAUACAUGUCUCUGGUAA RT-qPCR can be used to detect the variant (mutation). (a) (10 pts) In a few sentences or using a simple diagram/flowchart, describe the basic principle of RT-qPCR, and show the sequence of a DNA primer that can be used to reverse transcribe the entire RNA molecule as shown at 37 °C. (b) (5 pts) Design a pair of primers (DNA oligonucleotides) for detecting the mutation by qPCR. Assume that the PCR reaction will be performed at 72 °C. Show the sequences of your primers and their estimated Tm.