Page 1 of 1

3. a) (10 points) Point mutations in genes can cause neurogenerative diseases. Sequencing results of a gene related to A

Posted: Mon Jun 06, 2022 1:58 pm
by answerhappygod
3 A 10 Points Point Mutations In Genes Can Cause Neurogenerative Diseases Sequencing Results Of A Gene Related To A 1
3 A 10 Points Point Mutations In Genes Can Cause Neurogenerative Diseases Sequencing Results Of A Gene Related To A 1 (39.35 KiB) Viewed 17 times
3. a) (10 points) Point mutations in genes can cause neurogenerative diseases. Sequencing results of a gene related to Alzheimer disease from 10 different individuals (ID numbers from 1 to 10) were shown below (type: char). It is known that G to A mutation is an early indicator of disease. Write a MATLAB code that compares the sequence of individuals with reference and returns ID numbers and disease results into a cell array.102 1 2 11 22 no disease disease no disease 33 Reference sequence (healthy): 'tgagatgtgtacggggcgatcatecacatttatgcatttaatacgccgac Sequencing results of 10 patients: 'tgagatgtgtacggggcgatcatecacatttatgcatttaatacgcegac 'tgagatgtatacggggegatcatecacatttatgeatttaatacgccgac 'tgagatgtgtacggggcgatcatecacatttatgcatttaatacgecgac" 'tgagatgtgtacggggcgatcatecacatttatgcatttaatacgccgac 'tgagatgtatacggggcgatcatecacatttatgcatttaatacgecgac 'tgagatgtgtacggggegatcatecacatttatgcatttaatacgccgac 'tgagatgtatacggggegatcatecacatttatgeatttaatacgccgac 'tgagatgtgtacggggcgatcatecacatttatgcatttaatacgcegac 'tgagatgtgtacggggcgatcatecacatttatgcatttaatacgecgac 'tgagatgtatacggggegatcatecacatttatgcatttaatacgecgae' Type your code: