Answer Happy

Examine the results of the blast search shown below and answer the question. Mus musculus phosphofructokinase, liver, B-type (Pfkl), transcript variant 1, mRNA Sequence ID: NM_008826.5 Length: 3752 Number of Matches: 1 Range 1: 125 to 202 GenBank Graphics Next Match Previous Match Expect Identities Gaps Strand 7e-31 78/78(100%) 0/78(0%) Plus/Plus ATGGCTACCGTGGACCTGGAGAAACTGCGGATGTCGGGGGCTGGCAAGGCCATTGGAGTG 60 Score 145 bits(78) Query 1 Sbjct 125 Query 61 Sbjct 185 ATGGCTACCGTGGACCTGGAGAAACTGCGGATGTCGGGGGCTGGCAAGGCCATTGGAGTG 184 CTGACCAGCGGCGGTGAT 78 CTGACCAGCGGCGGTGAT 202 What is the organism in which the BLAST search found a perfect match? O Phosphofructokinase O Homo sapiens O Mus musculus OPfkl Question 14 Dideoxynucleotides are used in which process? O next generation sequencing O PCR O molecular cloning O chain termination sequencing