Page 1 of 1
2. A segment of DNA is known to contain the following base sequence: 3' GATACCTTTGTGTAGTCATCTT 5' a) Write the mRNA that
Posted: Mon May 23, 2022 8:13 am
by answerhappygod
- 2 A Segment Of Dna Is Known To Contain The Following Base Sequence 3 Gatacctttgtgtagtcatctt 5 A Write The Mrna That 1 (30.83 KiB) Viewed 20 times
2. A segment of DNA is known to contain the following base sequence: 3' GATACCTTTGTGTAGTCATCTT 5' a) Write the mRNA that would be transcribed from this DNA fragment. b) Circle the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. Use the mRNA codon table provided. c) Where in the cell do transcription and translation occur?