polymerase chain reaction, or PCR, amplinication, Repeat Region GAGGTACTGCGTAACACCAGGATACAA GATA GATA GATA GATA GATA GAT
Posted: Wed May 18, 2022 3:09 pm
polymerase chain reaction, or PCR, amplinication, Repeat Region GAGGTACTGCGTAACACCAGGATACAA GATA GATA GATA GATA GATA GATA CAGGTAATGOCGTCATTOOGA Flanking Region Flanking Region Figure 1. Each one of the rectangles above represents a repeat unit. In this example, the STR is comprised of six repeats of the four-base unit GATA. On either side of the STR is a flanking region of DNA. If you were to write out the STR sequence in Figure 1, it would be GATAGATAGATAGATAGATAGATA. For STRs with many repeat units, writing out the sequence can get very unwieldy, so geneticists use shorthand. The repeat unit is placed in brackets with a subscript indicating the number of times it repeats. The shorthand for the STR in the example above would be [GATA]6- 1. Identify the flanking sequences and the number of repeat units [GAAT) in the following STR, known as TPOX, on human chromosome 2: CCACACAGGTAATGAATGAATGAATGAATGAATGCCTAAGTGCC and a. partial flanking sequences: b. number of repeat units: 2. Write out the STR shown above using genetic shorthand.