Page 1 of 1

Use the provided genetic code table to answer these questions: 1. Identify the open reading frame in the following mRNA

Posted: Wed May 18, 2022 2:21 pm
by answerhappygod
Use The Provided Genetic Code Table To Answer These Questions 1 Identify The Open Reading Frame In The Following Mrna 1
Use The Provided Genetic Code Table To Answer These Questions 1 Identify The Open Reading Frame In The Following Mrna 1 (61.6 KiB) Viewed 51 times
Use the provided genetic code table to answer these questions: 1. Identify the open reading frame in the following mRNA sequence by a. writing out the actual coding sequence of nucleotides (5 points) b. writing out the amino acid sequence of the corresponding 8 amino acid peptide (5 points) mRNA: 5'- GCAUGAAGUGAUGGUUUCUUACGGUGGGGUGCCAUGACC - 3' 2. Explain how this particular sequence illustrates redundancy of the code & the wobble phenomenon? (5 points) 3. Indicate what happens to the peptide if a G replaces the C in the underlined position of the sequence. What is this kind of mutation called? (10 points) 4. Indicate what happens to the peptide if the Cis deleted? What kind of mutation is this? (10 points) 5. Indicate what happens to the peptide if the nucleotides GGG are inserted directly after the C? In the context of gene function, explain why a triplet insertion or deletion would be less detrimental than the single nucleotide insertion or deletion. (5 points)