Answer Question 3
Posted: Wed May 18, 2022 2:14 pm
Answer Question 3
a) Provide the recognition site and cleavage position of Rsal in dsDNA. What type of ends are generated by this enzyme? [2] b) The sequence below represents the 400 bp PCR amplicon of the HFE WT allele. Indicate the position and nature of the point mutation responsible for the C282Y mutation. Use a yellow highlight to Indicate the potential recognition site(s) for the enzyme Rsal. [2] gocaagggtfaacagatcccctctcctcatccttcctctttcctgtcaagtgcctcctttggtgaaggtgacacatcatgtgacctcttca gtgaccactctacggtgtcgggccttgaactactacccccagaacatcaccatgaagtggctgaaggataagcagecaatggatgcd aaggagttegaacctaaagacgtattgcccaatggggatgggacctaccagggctggataaccttggctgtaccccctggggaaga gcagagatatacgtgccaggtggagcacccaggcctggatcagcccctcattatgatctggggtatgtgactgatgagagccagga actoagaaaatctattaggagttgagaggagtacctgaggaggtaattat c) Using the line diagram below, indicate where you would fine the Rsal sites on your PCR amplicons for a patient who is heterozygous for the C282Y mutation. Include the fragment sizes. [3] d) You analyse DNA samples with your PCR RFLP assay developed above, followed by agarose gel electrophoresis. Draw the gel banding pattern with sizes you expect to observe for a wild type homozygote, mutant homozygote and heterozygote (carrier) Individual respectively. [3] WT/WT M/M WT/M Section D subtotal: 12 marks 7 +
a) Provide the recognition site and cleavage position of Rsal in dsDNA. What type of ends are generated by this enzyme? [2] b) The sequence below represents the 400 bp PCR amplicon of the HFE WT allele. Indicate the position and nature of the point mutation responsible for the C282Y mutation. Use a yellow highlight to Indicate the potential recognition site(s) for the enzyme Rsal. [2] gocaagggtfaacagatcccctctcctcatccttcctctttcctgtcaagtgcctcctttggtgaaggtgacacatcatgtgacctcttca gtgaccactctacggtgtcgggccttgaactactacccccagaacatcaccatgaagtggctgaaggataagcagecaatggatgcd aaggagttegaacctaaagacgtattgcccaatggggatgggacctaccagggctggataaccttggctgtaccccctggggaaga gcagagatatacgtgccaggtggagcacccaggcctggatcagcccctcattatgatctggggtatgtgactgatgagagccagga actoagaaaatctattaggagttgagaggagtacctgaggaggtaattat c) Using the line diagram below, indicate where you would fine the Rsal sites on your PCR amplicons for a patient who is heterozygous for the C282Y mutation. Include the fragment sizes. [3] d) You analyse DNA samples with your PCR RFLP assay developed above, followed by agarose gel electrophoresis. Draw the gel banding pattern with sizes you expect to observe for a wild type homozygote, mutant homozygote and heterozygote (carrier) Individual respectively. [3] WT/WT M/M WT/M Section D subtotal: 12 marks 7 +
a) Provide the recognition site and cleavage position of Rsal in dsDNA. What type of ends are generated by this enzyme? [2] b) The sequence below represents the 400 bp PCR amplicon of the HFE WT allele. Indicate the position and nature of the point mutation responsible for the C282Y mutation. Use a yellow highlight to Indicate the potential recognition site(s) for the enzyme Rsal. [2] gocaagggtfaacagatcccctctcctcatccttcctctttcctgtcaagtgcctcctttggtgaaggtgacacatcatgtgacctcttca gtgaccactctacggtgtcgggccttgaactactacccccagaacatcaccatgaagtggctgaaggataagcagecaatggatgcd aaggagttegaacctaaagacgtattgcccaatggggatgggacctaccagggctggataaccttggctgtaccccctggggaaga gcagagatatacgtgccaggtggagcacccaggcctggatcagcccctcattatgatctggggtatgtgactgatgagagccagga actoagaaaatctattaggagttgagaggagtacctgaggaggtaattat c) Using the line diagram below, indicate where you would fine the Rsal sites on your PCR amplicons for a patient who is heterozygous for the C282Y mutation. Include the fragment sizes. [3] d) You analyse DNA samples with your PCR RFLP assay developed above, followed by agarose gel electrophoresis. Draw the gel banding pattern with sizes you expect to observe for a wild type homozygote, mutant homozygote and heterozygote (carrier) Individual respectively. [3] WT/WT M/M WT/M Section D subtotal: 12 marks 7 +
4. You prepare a linear PGREEN plasmid by digestion with the enzyme identified In (3) above, ligate it to the PCR product, and transform it into bacteria. What phenotype wold you expect for bacteria that have taken up recombinant plasmids, versus those with non-recombinant plasmids? [3] 5. With a non-directional cloning such as this, recombinant plasmids can contain an insert ligated Into the vector in two different orientations. Explain how a double digest with NotI and Rsal will allow you to distinguish between these two types of recombinants. [2] 6. Will a bacterium containing a recombinant plasmid be able to the express the part of the human protein encoded by the HFE gene exon 4? Motivate your answer [2]
a) Provide the recognition site and cleavage position of Rsal in dsDNA. What type of ends are generated by this enzyme? [2] b) The sequence below represents the 400 bp PCR amplicon of the HFE WT allele. Indicate the position and nature of the point mutation responsible for the C282Y mutation. Use a yellow highlight to Indicate the potential recognition site(s) for the enzyme Rsal. [2] gocaagggtfaacagatcccctctcctcatccttcctctttcctgtcaagtgcctcctttggtgaaggtgacacatcatgtgacctcttca gtgaccactctacggtgtcgggccttgaactactacccccagaacatcaccatgaagtggctgaaggataagcagecaatggatgcd aaggagttegaacctaaagacgtattgcccaatggggatgggacctaccagggctggataaccttggctgtaccccctggggaaga gcagagatatacgtgccaggtggagcacccaggcctggatcagcccctcattatgatctggggtatgtgactgatgagagccagga actoagaaaatctattaggagttgagaggagtacctgaggaggtaattat c) Using the line diagram below, indicate where you would fine the Rsal sites on your PCR amplicons for a patient who is heterozygous for the C282Y mutation. Include the fragment sizes. [3] d) You analyse DNA samples with your PCR RFLP assay developed above, followed by agarose gel electrophoresis. Draw the gel banding pattern with sizes you expect to observe for a wild type homozygote, mutant homozygote and heterozygote (carrier) Individual respectively. [3] WT/WT M/M WT/M Section D subtotal: 12 marks 7 +
a) Provide the recognition site and cleavage position of Rsal in dsDNA. What type of ends are generated by this enzyme? [2] b) The sequence below represents the 400 bp PCR amplicon of the HFE WT allele. Indicate the position and nature of the point mutation responsible for the C282Y mutation. Use a yellow highlight to Indicate the potential recognition site(s) for the enzyme Rsal. [2] gocaagggtfaacagatcccctctcctcatccttcctctttcctgtcaagtgcctcctttggtgaaggtgacacatcatgtgacctcttca gtgaccactctacggtgtcgggccttgaactactacccccagaacatcaccatgaagtggctgaaggataagcagecaatggatgcd aaggagttegaacctaaagacgtattgcccaatggggatgggacctaccagggctggataaccttggctgtaccccctggggaaga gcagagatatacgtgccaggtggagcacccaggcctggatcagcccctcattatgatctggggtatgtgactgatgagagccagga actoagaaaatctattaggagttgagaggagtacctgaggaggtaattat c) Using the line diagram below, indicate where you would fine the Rsal sites on your PCR amplicons for a patient who is heterozygous for the C282Y mutation. Include the fragment sizes. [3] d) You analyse DNA samples with your PCR RFLP assay developed above, followed by agarose gel electrophoresis. Draw the gel banding pattern with sizes you expect to observe for a wild type homozygote, mutant homozygote and heterozygote (carrier) Individual respectively. [3] WT/WT M/M WT/M Section D subtotal: 12 marks 7 +
a) Provide the recognition site and cleavage position of Rsal in dsDNA. What type of ends are generated by this enzyme? [2] b) The sequence below represents the 400 bp PCR amplicon of the HFE WT allele. Indicate the position and nature of the point mutation responsible for the C282Y mutation. Use a yellow highlight to Indicate the potential recognition site(s) for the enzyme Rsal. [2] gocaagggtfaacagatcccctctcctcatccttcctctttcctgtcaagtgcctcctttggtgaaggtgacacatcatgtgacctcttca gtgaccactctacggtgtcgggccttgaactactacccccagaacatcaccatgaagtggctgaaggataagcagecaatggatgcd aaggagttegaacctaaagacgtattgcccaatggggatgggacctaccagggctggataaccttggctgtaccccctggggaaga gcagagatatacgtgccaggtggagcacccaggcctggatcagcccctcattatgatctggggtatgtgactgatgagagccagga actoagaaaatctattaggagttgagaggagtacctgaggaggtaattat c) Using the line diagram below, indicate where you would fine the Rsal sites on your PCR amplicons for a patient who is heterozygous for the C282Y mutation. Include the fragment sizes. [3] d) You analyse DNA samples with your PCR RFLP assay developed above, followed by agarose gel electrophoresis. Draw the gel banding pattern with sizes you expect to observe for a wild type homozygote, mutant homozygote and heterozygote (carrier) Individual respectively. [3] WT/WT M/M WT/M Section D subtotal: 12 marks 7 +
4. You prepare a linear PGREEN plasmid by digestion with the enzyme identified In (3) above, ligate it to the PCR product, and transform it into bacteria. What phenotype wold you expect for bacteria that have taken up recombinant plasmids, versus those with non-recombinant plasmids? [3] 5. With a non-directional cloning such as this, recombinant plasmids can contain an insert ligated Into the vector in two different orientations. Explain how a double digest with NotI and Rsal will allow you to distinguish between these two types of recombinants. [2] 6. Will a bacterium containing a recombinant plasmid be able to the express the part of the human protein encoded by the HFE gene exon 4? Motivate your answer [2]