Page 1 of 1

The following questions require you to identify key regulatory sequences within the regulatory region sequence of the Ar

Posted: Wed May 18, 2022 1:46 pm
by answerhappygod
The Following Questions Require You To Identify Key Regulatory Sequences Within The Regulatory Region Sequence Of The Ar 1
The Following Questions Require You To Identify Key Regulatory Sequences Within The Regulatory Region Sequence Of The Ar 1 (83.73 KiB) Viewed 42 times
a) AraPB1 (75 words) 3 marks
b) AraPB2 (75 words) 3 marks
c)AraPB3 (75 words) 3 marks
d)AraPB4 (75 words) 3 marks
The following questions require you to identify key regulatory sequences within the regulatory region sequence of the Arapa wildtype sequence, in comparison to Arapß mutant sequences. The following table will help you identify these sequences. Nucleotide residues shown in bold are critical for function, those that are not bold can be exchanged for other nucleotides without any change in function. Arac binding sites are NOT PALINDROMIC (read the same backwards as forwards). Regulatory element Nucleotide sequence Shown in 5'-3' orientation (left to right) of the coding strand Promoter TATAAT Arac binding site 1 CCAGAAAAGTCCACATTGAT Ara binding site 2 TTGCTATGCCATAGCATT Using ClustalOmega (available here), compare the nucleotide sequence of the regulatory region for each of the reporter gene variants to the wildtype. Ensure that you keep the “>Ara..." header for each sequence as this tells the software where one sequence ends and another begins. You can simply copy and paste the nucleotide sequences provided on Moodle (including the headers) into the submission box on the Clustal website, make sure that each
Promoter ТАТААТ Arac binding site 1 CCAGAAAAGTCCACATTGAT AraC binding site 2 TTGCTATGCCATAGCATT Using ClustalOmega (available here), compare the nucleotide sequence of the regulatory region for each of the reporter gene variants to the wildtype. Ensure that you keep the “>Ara...” header for each sequence as this tells the software where one sequence ends and another begins. You can simply copy and paste the nucleotide sequences provided on Moodle (including the headers) into the submission box on the Clustal website, make sure that each time you include the wildtype sequence for comparison, ensure that you select DNA from the dropdown box. For each Clustalomega alignment, ensure that you compare the wildtype sequence with at least ONE of the mutant sequences. b) Based on your in silico analysis (as described in the accompanying video) of each of the reporter constructs, describe how the phenotype displayed in the lab might be explained through a mutation. Ensure that you justify your response by stating how the mutations would result in a change in the transcription of the reporter gene. AraPB1 (75 words max - 3 marks):