Page 1 of 1

Go to the site for the National Center for Biotechnology Information (NCBI) at http://www.ncbi.nlm.nih.gov Under Popular

Posted: Tue May 17, 2022 7:01 pm
by answerhappygod
Go To The Site For The National Center For Biotechnology Information Ncbi At Http Www Ncbi Nlm Nih Gov Under Popular 1
Go To The Site For The National Center For Biotechnology Information Ncbi At Http Www Ncbi Nlm Nih Gov Under Popular 1 (61.88 KiB) Viewed 96 times
Go to the site for the National Center for Biotechnology Information (NCBI) at http://www.ncbi.nlm.nih.gov Under Popular Resources, click on BLAST Click on nucleotide blast Copy and paste the following sequence into the box (this is a segment of the DNA sequence for the TLR7 gene. I have altered one base that represents the mutation described in the earlier article, or one really similar to it) TGTTATGTTTCATATTCAATAGAGAAAGATGCCTTCCTAAAC TTGACAA AGTTAAAAGTGCTCTCCCTGAAAGATAACAATGTCACAGCC GTCCCCACT GTTTTGCCATCTACTTTAACAGAACTATATCTCTACAACAAC ATGATTGC AAAAATCCAAGAAGATGATTTTAATAACCTCAACCAATTACA AATTCTTG See that the database is set to Nucleotide collection (nr/nt) Optimize for highly similar sequences Hit the big blue BLAST button Be patient, it may take a minute for the results to appear. The results that appear represent alignments between your submitted sequence (the Query) and sequences from the database (Subject) Scroll down to the links for sequences producing significant alignments" Click on the link for the result: Homo sapiens toll like receptor 7 (TLR7), mRNA. This was the top result when I wrote the assignment This will take you to an alignment of your submitted sequence (Query, the mutated version) and the sequence from the database (Subject, normal form). Where the nucleotide bases are the same between the two sequences there is a vertical line connecting them. Where they differ no line is present. 9. (1 point) There is only one base change involved in this mutant form of the gene. What is the base in the normal copy and what does it change to in the mutant copy?