2. a) What is the reason for the following microsatellite? b) Indicates the number of repetitions of the motif in the fo
Posted: Tue May 17, 2022 6:46 pm
2. a) What is the reason for the following microsatellite? b) Indicates the number of repetitions of the motif in the following microsatellite and c) Indicates the number of base pairs (bp) of the following microsatellite. (6pts) <- AGCTACATACATACATACATACATACATACAGCT -> <- TCGATGTATGTATGTATGTATGTATGTATGTCGA ->