please answer legibly thanks!
Posted: Tue May 17, 2022 6:31 pm
please answer legibly thanks!
The following mRNA is found in both eukaryotes and prokaryotes. 5 AGCAAACUAAGGAGGUACGAUGUACUUGCCACCAUGACCGCUGAGUE 3 a. What would be the first 5 amino acids translated from this mRNA in prokaryotes? b. What would be the first 5 amino acids translated from this mRNA in eukaryotes: c. Briefly explain why your answers to a and b are different (big hint here- they should be different!).
- Please Answer Legibly Thanks 1 (34.88 KiB) Viewed 123 times