• Reason: ** • Number of repetitions: ** • Base pairs (bp):**

Business, Finance, Economics, Accounting, Operations Management, Computer Science, Electrical Engineering, Mechanical Engineering, Civil Engineering, Chemical Engineering, Algebra, Precalculus, Statistics and Probabilty, Advanced Math, Physics, Chemistry, Biology, Nursing, Psychology, Certifications, Tests, Prep, and more.
Post Reply
answerhappygod
Site Admin
Posts: 899604
Joined: Mon Aug 02, 2021 8:13 am

• Reason: ** • Number of repetitions: ** • Base pairs (bp):**

Post by answerhappygod »

• Reason: **
• Number of repetitions: **
• Base pairs (bp):**
Reason Number Of Repetitions Base Pairs Bp 1
Reason Number Of Repetitions Base Pairs Bp 1 (9.64 KiB) Viewed 165 times
<- AGCTACATACATACATACATACATACATACAGCT -> TCGATGTATGTATGTATGTATGTATGTATGTCGA->
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!
Top
Post Reply

Return to “Archived Questions & Answers”