Page 1 of 1
DNA Transcription and Genetic Code (5 pts) Translate the below strand of DNA into mRNA (5 pts) TACGGAGAAAGGGCGTCATCGGCGA
Posted: Tue May 17, 2022 3:55 pm
by answerhappygod
- Dna Transcription And Genetic Code 5 Pts Translate The Below Strand Of Dna Into Mrna 5 Pts Tacggagaaagggcgtcatcggcga 1 (32.95 KiB) Viewed 107 times
DNA Transcription and Genetic Code (5 pts) Translate the below strand of DNA into mRNA (5 pts) TACGGAGAAAGGGCGTCATCGGCGA CT RNA Use the Codon Dictionary to transcribe the amino acids from the above RNA (5 pts) JU CDC RO OU CU CU BAR LE TC AU AL . 333333333333 BOSSAB Translation (10 pts) Fill out the below diagram of Translation-Elongation. A) Large subunit B)Polypeptide chain C) Small D) EPA sites E) tRNA F) Amino Acid (10 pts) LLLL Extra Credit (10 pts) Consider the below pedigree and provide an explanation for what is occurring. How is this trait inherited? Is it sex linked? Why or why not. (5 pts)