Page 1 of 1
Question 63 The stretch of DNA below will ultimately end up as a which of the following sequences of amino acids? 3' - T
Posted: Tue May 17, 2022 3:27 pm
by answerhappygod
- Question 63 The Stretch Of Dna Below Will Ultimately End Up As A Which Of The Following Sequences Of Amino Acids 3 T 1 (27.43 KiB) Viewed 251 times
Question 63 The stretch of DNA below will ultimately end up as a which of the following sequences of amino acids? 3' - TATAAAACATACGTCACCTTGCTGACT - 5 Click here for a codon table. met - gin - trp - asn - asn met - phe-ser-met-gin-trpasn- glu met - gin - trp - asn - his gin-trpasn-his-stop O ile - phelys-met-gin-trpasn - his