Given the following prokaryote sequence of DNA Identify if any promoter sequences are present in DNA SEO1 Highlight/Unde
Posted: Tue May 17, 2022 2:55 pm
Given the following prokaryote sequence of DNA Identify if any promoter sequences are present in DNA SEO1 Highlight/Underline these in e in the sequence Predict the mRNA sequence that would arise from this DNA sequence Identify the ribosome binding site, start and stop codons (if present), CHighlight Underline these in the sequences Predict the sequence of the peptide that would arise from the predicted mRNA sequence using the genetic code table isee Codon usage table Based on your knowledge of the properties of amino acids speculate on the properties of the predicted peptideleg charge, hydrophobicity, aromaticity STAAAATCACCTTTCATTGACACCACAATCACATCTCTACGTATAATGAATTTAAAGCGGAGGCAAATTTGOCCCCCAATGCITITIGICGACITCGACITTAATGCTOMMAGGAGGCAMATGAAMACIT 3