1. DNA consists of two complementary strands of A, T, G, and C nucleotides. a) Write the sequence of the complementary s
Posted: Tue May 17, 2022 2:09 pm
1. DNA consists of two complementary strands of A, T, G, and C nucleotides. a) Write the sequence of the complementary strand of DNA Immediately below the sequence of DNA provided. Make it obvious which nucleotide in the template strand pair with which nucleotide in the complementary strand. b) Indicate the 3' and 5' ends. SHOW and EXPLAIN how you determined the complementary sequence of nucleotides, or you will not get points (4 points). 3 AAATACCGTTGACACGCAACT 5' c) What is the sequence of mRNA complementary to this sequence of DNA? Indicate the 3' and 5' ends. SHOW and EXPLAIN how you determined the complementary sequence of nucleotides, or you will NOT get any points (4 points) 3' AAATACCGTTGACACGCAACT 5 d) Copy and paste below the sequence of nucleotides of the mRNA you obtained in the previous questions. Mark EACH codon in the mRNA and show which amino acid is translated. SHOW and EXPLAIN how YOU doduced the sequence of amino acids in the new protein, or you will NOT get any points (12 points)