Page 1 of 1

100% a) Provide the recognition site and cleavage position of Rsal in dsDNA. What type of ends are generated by this enz

Posted: Tue May 17, 2022 1:04 pm
by answerhappygod
100 A Provide The Recognition Site And Cleavage Position Of Rsal In Dsdna What Type Of Ends Are Generated By This Enz 1
100 A Provide The Recognition Site And Cleavage Position Of Rsal In Dsdna What Type Of Ends Are Generated By This Enz 1 (68.71 KiB) Viewed 85 times
100 A Provide The Recognition Site And Cleavage Position Of Rsal In Dsdna What Type Of Ends Are Generated By This Enz 2
100 A Provide The Recognition Site And Cleavage Position Of Rsal In Dsdna What Type Of Ends Are Generated By This Enz 2 (21.96 KiB) Viewed 85 times
100% a) Provide the recognition site and cleavage position of Rsal in dsDNA. What type of ends are generated by this enzyme? [2] b) The sequence below represents the 400 bp PCR amplicon of the HFE WT allele. Indicate the position and nature of the point mutation responsible for the C282Y mutation. Use a yellow highlight to indicate the potential recognition site(s) for the enzyme Rsal, [2] ggcaagggtaaacagatcccctctcctcatccttcctctttcctatcaagtgcctcctttogtgaangtgacacatcatalgacctcttca atgaccactctacgatakegagccttgaactactacccccagaacatcaccatgaagtagctgaaggalaagcagccaatggaged aaggagttegaacctaaagacgtattgoccaatggggatgogacctaccagggctggataaccttggctgtaccccctggggaaga gcagagatatacgtgccaggtggagcacccaggcctggatcagcccctcattatgatctggggtatgtgactgatgagagccagga gctgagaaaatctattgggggttgagaggagtgcctgaggaggtaattat c) Using the line diagram below, indicate where you would fine the Rsal sites on your PCR amplicons for a patient who is heterozygous for the C282Y mutation. Include the fragment sizes, [3] d) You analyse DNA samples with your PCR RFLP assay developed above, followed by agarose gel electrophoresis. Draw the gel banding pattern with sizes you expect to observe for a wild type homozygote, mutant homozygote and heterozygote (carrier) individual respectively. [3] WT/WT M/M WI/M Section D subtotal: 12 marks

ggcaagggtaaacagatcccctctcctcatccttcctctttcctgtcaagtgcctcctttggtgaaggtgacacatcatgtgacctcttca gtgaccactctacagtgtcgggccttgaactactacccccagaacatcaccatgaagtggctgaaggataagcagccaatagatgcc aaggagttegaacctaaagacgtattgcccaatggggatgggacctaccagggctggataaccttggctglaccccctggggaaga gcagagatatacgtgccaggtggagcacccaggcctggatcagcccctcattgtgatctggggtatgtgactgatgagagccagga gotgagaaaatctattgggggttgagaggagtgcctgaggaggtaattat