Page 1 of 1
Answer the following questions using the unknown sequence below. You can also find the unknown sequence file in the LMS
Posted: Mon May 02, 2022 12:27 pm
by answerhappygod
- Answer The Following Questions Using The Unknown Sequence Below You Can Also Find The Unknown Sequence File In The Lms 1 (20.09 KiB) Viewed 44 times
Answer the following questions using the unknown sequence below. You can also find the unknown sequence file in the LMS named as "BIOL312_MidtermExam_UnknownSequence GTGGCCAAGAGGGAAAGCCGGGGCCTCAAGTCTGGCCTCAAGACCGACAAGTCGGACTCGGAGCAAGT GACGCTCCGCATCCATCGGAAAAACGCCCCGGCAGGAGGCAGCGGGATGGCCAGCGCCAAGACCAAGACG CACTTCTCAGTGAGGCTCCTCAAGTTCTCCCGGGAGAAGAAAGCGGCCAAAACGCTGGGO a) Identify the unknown sequence. What are the name and the accession number of the gene identified. (2 points) b) How many open reading frames are found in this sequence? (1 points) c) Search the protein of that gene in UniProt database. Write down the Unitati and Go-Molecular function (3 points) a) write down the exact name(s) of the specific software(s)program(s) you used to answer the questions. (1.5 point)