Answer the following questions using the unknown sequence below. You can also find the unknown sequence file in the LMS

Business, Finance, Economics, Accounting, Operations Management, Computer Science, Electrical Engineering, Mechanical Engineering, Civil Engineering, Chemical Engineering, Algebra, Precalculus, Statistics and Probabilty, Advanced Math, Physics, Chemistry, Biology, Nursing, Psychology, Certifications, Tests, Prep, and more.
Post Reply
answerhappygod
Site Admin
Posts: 899604
Joined: Mon Aug 02, 2021 8:13 am

Answer the following questions using the unknown sequence below. You can also find the unknown sequence file in the LMS

Post by answerhappygod »

Answer The Following Questions Using The Unknown Sequence Below You Can Also Find The Unknown Sequence File In The Lms 1
Answer The Following Questions Using The Unknown Sequence Below You Can Also Find The Unknown Sequence File In The Lms 1 (20.09 KiB) Viewed 42 times
Answer the following questions using the unknown sequence below. You can also find the unknown sequence file in the LMS named as "BIOL312_MidtermExam_UnknownSequence GTGGCCAAGAGGGAAAGCCGGGGCCTCAAGTCTGGCCTCAAGACCGACAAGTCGGACTCGGAGCAAGT GACGCTCCGCATCCATCGGAAAAACGCCCCGGCAGGAGGCAGCGGGATGGCCAGCGCCAAGACCAAGACG CACTTCTCAGTGAGGCTCCTCAAGTTCTCCCGGGAGAAGAAAGCGGCCAAAACGCTGGGO a) Identify the unknown sequence. What are the name and the accession number of the gene identified. (2 points) b) How many open reading frames are found in this sequence? (1 points) c) Search the protein of that gene in UniProt database. Write down the Unitati and Go-Molecular function (3 points) a) write down the exact name(s) of the specific software(s)program(s) you used to answer the questions. (1.5 point)
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!
Post Reply