Page 1 of 1
GTGGCCAAGAGGGAAAGCCGGGGCCTCAAGTCTGGCCTCAAGACCGACAAGTCGGACTCGGAG CAAGT GACGCTCCGCATCCATCGGAAAAACGCCCCGGCAGGAGGCAGCGGGATGG
Posted: Mon May 02, 2022 12:27 pm
by answerhappygod
- Gtggccaagagggaaagccggggcctcaagtctggcctcaagaccgacaagtcggactcggag Caagt Gacgctccgcatccatcggaaaaacgccccggcaggaggcagcgggatgg 1 (41.35 KiB) Viewed 26 times
GTGGCCAAGAGGGAAAGCCGGGGCCTCAAGTCTGGCCTCAAGACCGACAAGTCGGACTCGGAG CAAGT GACGCTCCGCATCCATCGGAAAAACGCCCCGGCAGGAGGCAGCGGGATGGCCAGCGCCAAGAC CAAGACG CACTTCTCAGTGAGGCTCCTCAAGTTCTCCCGGGAGAAGAAAGCGGCCAAAACGCTGGGC a) Identify the unknown sequence. What are the name and the accession number of the gene identified. (2 points) b) How many open reading frames are found in this sequence? (1 points) c) Search the protein of that gene infUniProt database. Write down the Uniprot ID and GO- Molecular functions. (3 points) d) Write down the exact name(s) of the specific software(s)/program(s) you used to answer the questions. (1.5 point)