6. A segment of a polypeptide chain is Ser-Pro-Arg-Lys-Gln-Leu-Ala, encoded by the following DNA (the sequence aligns so

Business, Finance, Economics, Accounting, Operations Management, Computer Science, Electrical Engineering, Mechanical Engineering, Civil Engineering, Chemical Engineering, Algebra, Precalculus, Statistics and Probabilty, Advanced Math, Physics, Chemistry, Biology, Nursing, Psychology, Certifications, Tests, Prep, and more.
Post Reply
answerhappygod
Site Admin
Posts: 899603
Joined: Mon Aug 02, 2021 8:13 am

6. A segment of a polypeptide chain is Ser-Pro-Arg-Lys-Gln-Leu-Ala, encoded by the following DNA (the sequence aligns so

Post by answerhappygod »

6 A Segment Of A Polypeptide Chain Is Ser Pro Arg Lys Gln Leu Ala Encoded By The Following Dna The Sequence Aligns So 1
6 A Segment Of A Polypeptide Chain Is Ser Pro Arg Lys Gln Leu Ala Encoded By The Following Dna The Sequence Aligns So 1 (29.99 KiB) Viewed 79 times
6. A segment of a polypeptide chain is Ser-Pro-Arg-Lys-Gln-Leu-Ala, encoded by the following DNA (the sequence aligns so the first amino acid starts with the first nucleotide of one of the strands/ directions): GCGATCGACGAAGGAACCCCT |||| ||||| CGCTAGCTGCTTCCTTGGGGA a) Which strand is the coding strand (top or bottom)? b) Which strand is a template stand (top or bottom)? c) Label each strand with polarity (5' or 3') d) What is the mRNA sequence? (Write below and label the 5' and 3' ends of your mRNA): 7. For the polypeptide sequence (a very tiny protein, only 3 amino acids): Met-Trp-Phe. Write out are all of the possible mRNA strands that can encode this protein sequence. (Hint, there are six)
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!
Post Reply