please answer legibly thanks!

Business, Finance, Economics, Accounting, Operations Management, Computer Science, Electrical Engineering, Mechanical Engineering, Civil Engineering, Chemical Engineering, Algebra, Precalculus, Statistics and Probabilty, Advanced Math, Physics, Chemistry, Biology, Nursing, Psychology, Certifications, Tests, Prep, and more.
Post Reply
answerhappygod
Site Admin
Posts: 899604
Joined: Mon Aug 02, 2021 8:13 am

please answer legibly thanks!

Post by answerhappygod »

please answer legibly thanks!
Please Answer Legibly Thanks 1
Please Answer Legibly Thanks 1 (34.88 KiB) Viewed 122 times
The following mRNA is found in both eukaryotes and prokaryotes. 5 AGCAAACUAAGGAGGUACGAUGUACUUGCCACCAUGACCGCUGAGUE 3 a. What would be the first 5 amino acids translated from this mRNA in prokaryotes? b. What would be the first 5 amino acids translated from this mRNA in eukaryotes: c. Briefly explain why your answers to a and b are different (big hint here- they should be different!).
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!
Post Reply