please answer legibly thanks!
The following mRNA is found in both eukaryotes and prokaryotes. 5 AGCAAACUAAGGAGGUACGAUGUACUUGCCACCAUGACCGCUGAGUE 3 a. What would be the first 5 amino acids translated from this mRNA in prokaryotes? b. What would be the first 5 amino acids translated from this mRNA in eukaryotes: c. Briefly explain why your answers to a and b are different (big hint here- they should be different!).
please answer legibly thanks!
-
answerhappygod
- Site Admin
- Posts: 899604
- Joined: Mon Aug 02, 2021 8:13 am
please answer legibly thanks!
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!