Given the following prokaryote sequence of DNA:
Identify if any promoter sequences are present in DNA SEQ1
(Highlight/Underline these in the sequence)
Predict the mRNA sequence that would arise from this DNA
sequence.
Identify the ribosome binding site, start and stop codons (if
present). (Highlight/Underline these in the sequence).
Predict the sequence of the peptide that would arise from the
predicted mRNA sequence using the genetic code table (see Codon
usage table).
Based on your knowledge of the properties of amino acids
speculate on the properties of the predicted peptide (e.g. charge,
hydrophobicity, aromaticity)
3’ATTTTAGTGGAAAGTAACTGTGGTGTTAGTGTAGAGATGCATATTACTTAAATTTCGCCTCCGTTTAAACGGGGGGTTACGAAAAACAGCTGAAGCTGAAATTTACGAGTTTTCCTCCGTTTACTTTTGAA
5’
Given the following prokaryote sequence of DNA: Identify if any promoter sequences are present in DNA SEQ1 (Highlight/Un
-
answerhappygod
- Site Admin
- Posts: 899604
- Joined: Mon Aug 02, 2021 8:13 am
Given the following prokaryote sequence of DNA: Identify if any promoter sequences are present in DNA SEQ1 (Highlight/Un
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!